|
Left Crispr |
Right Crispr |
Crispr ID |
1014674717 |
1014674725 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:124349316-124349338
|
6:124349335-124349357
|
Sequence |
CCCGAGGCTCCACCCCATTCTCC |
CTCCCAGTGCACAGGCCGGTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 27, 2: 47, 3: 147, 4: 614} |
{0: 4, 1: 25, 2: 73, 3: 121, 4: 212} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|