ID: 1014700885_1014700890

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1014700885 1014700890
Species Human (GRCh38) Human (GRCh38)
Location 6:124686478-124686500 6:124686506-124686528
Sequence CCTTTAAACAACCAGATCTCATA CTATAACAAGAACAGCACTAGGG
Strand - +
Off-target summary {0: 5, 1: 42, 2: 134, 3: 242, 4: 457} {0: 1, 1: 13, 2: 100, 3: 621, 4: 2257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!