ID: 1014734289_1014734295

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1014734289 1014734295
Species Human (GRCh38) Human (GRCh38)
Location 6:125074026-125074048 6:125074066-125074088
Sequence CCAACCTCTCTGTAAGGCAGAAG AGTCACCCACTGGAAAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 366} {0: 1, 1: 0, 2: 1, 3: 24, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!