ID: 1014928133_1014928141

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1014928133 1014928141
Species Human (GRCh38) Human (GRCh38)
Location 6:127299312-127299334 6:127299327-127299349
Sequence CCCCTGAAGATGTTCCAGTGGGG CAGTGGGGTAAGATGTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 32, 3: 336, 4: 606} {0: 1, 1: 1, 2: 9, 3: 42, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!