ID: 1014988824_1014988829

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1014988824 1014988829
Species Human (GRCh38) Human (GRCh38)
Location 6:128048420-128048442 6:128048441-128048463
Sequence CCGCATATGTTCCCTCTGCCTCT CTAATGCTCCTGCCCTACATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 928} {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!