ID: 1015068640_1015068645

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1015068640 1015068645
Species Human (GRCh38) Human (GRCh38)
Location 6:129061627-129061649 6:129061677-129061699
Sequence CCCACACAGTATCTTAAGAATTA CCTCCCATTTAGTTTAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 266} {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!