ID: 1015082209_1015082213

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1015082209 1015082213
Species Human (GRCh38) Human (GRCh38)
Location 6:129240550-129240572 6:129240591-129240613
Sequence CCATCAACATCCTGGTCACACCT TTGTCAACTACTCTCTTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223} {0: 1, 1: 0, 2: 0, 3: 13, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!