ID: 1015111454_1015111460

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1015111454 1015111460
Species Human (GRCh38) Human (GRCh38)
Location 6:129596449-129596471 6:129596468-129596490
Sequence CCTTCCCAATTCCCCTTGTTCTG TCTGTTGTTTTTATTACTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 107, 4: 1501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!