ID: 1015190603_1015190611

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1015190603 1015190611
Species Human (GRCh38) Human (GRCh38)
Location 6:130467816-130467838 6:130467856-130467878
Sequence CCTCCCTCCCTCTGCTCACTCTG AAGAAGGCAGGTCTTGTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 152, 4: 1445} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!