ID: 1015261363_1015261370

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015261363 1015261370
Species Human (GRCh38) Human (GRCh38)
Location 6:131241257-131241279 6:131241280-131241302
Sequence CCTGCACTTGGCATTTGCAGTGG ATGGAGAAGGAGAAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212} {0: 1, 1: 6, 2: 119, 3: 872, 4: 4524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!