ID: 1015307519_1015307521

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1015307519 1015307521
Species Human (GRCh38) Human (GRCh38)
Location 6:131726314-131726336 6:131726341-131726363
Sequence CCTGTAGCTTGCAAGACAATGTG TATTAGATAAAGGTTGTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97} {0: 1, 1: 0, 2: 1, 3: 19, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!