ID: 1015503011_1015503033

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1015503011 1015503033
Species Human (GRCh38) Human (GRCh38)
Location 6:133952985-133953007 6:133953032-133953054
Sequence CCTCTTACCTCCCACCGAGCCCA TTGGGGACCAGGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 48, 4: 681} {0: 1, 1: 0, 2: 9, 3: 94, 4: 808}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!