ID: 1015525664_1015525672

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1015525664 1015525672
Species Human (GRCh38) Human (GRCh38)
Location 6:134173962-134173984 6:134174015-134174037
Sequence CCTTACAGTTCTCCACAGATGCA GGGTTGGCATTCATAAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 349} {0: 1, 1: 0, 2: 0, 3: 10, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!