ID: 1015541413_1015541425

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015541413 1015541425
Species Human (GRCh38) Human (GRCh38)
Location 6:134317796-134317818 6:134317819-134317841
Sequence CCTCCCCGCCCCCAGCTACCTGG CTGCTCTTCCGCGGCCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 82, 4: 741} {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!