ID: 1015545457_1015545460

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015545457 1015545460
Species Human (GRCh38) Human (GRCh38)
Location 6:134356872-134356894 6:134356895-134356917
Sequence CCTTCATTTATTCAATCAATCAT CTTTTCACAGACATGGAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!