ID: 1015768279_1015768282

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1015768279 1015768282
Species Human (GRCh38) Human (GRCh38)
Location 6:136742484-136742506 6:136742530-136742552
Sequence CCCTCTGCAGAAATTAACTCAAA ATGAAAAACTATAAAACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 138, 3: 1221, 4: 6853} {0: 2, 1: 9, 2: 39, 3: 151, 4: 780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!