ID: 1015903390_1015903391

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1015903390 1015903391
Species Human (GRCh38) Human (GRCh38)
Location 6:138090616-138090638 6:138090633-138090655
Sequence CCACTCAAAAATTGGTTTTGGAC TTGGACACCTAAAATGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 171} {0: 1, 1: 0, 2: 4, 3: 93, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!