ID: 1015924010_1015924020

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1015924010 1015924020
Species Human (GRCh38) Human (GRCh38)
Location 6:138291900-138291922 6:138291930-138291952
Sequence CCCTGAGCACGGCCCCTGTCGTC TGTCCATCCAGGACCTCGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!