ID: 1015927282_1015927288

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1015927282 1015927288
Species Human (GRCh38) Human (GRCh38)
Location 6:138323000-138323022 6:138323047-138323069
Sequence CCAAGCAGAAGAACAAAATAGCA TTTTGCTTGTAGAGGAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 410} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!