ID: 1015983567_1015983572

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1015983567 1015983572
Species Human (GRCh38) Human (GRCh38)
Location 6:138863514-138863536 6:138863552-138863574
Sequence CCAAACGGTAGCACATTTGGCTC TGGCCTAGCAGAGCACAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41} {0: 1, 1: 0, 2: 3, 3: 22, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!