ID: 1015985545_1015985554

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1015985545 1015985554
Species Human (GRCh38) Human (GRCh38)
Location 6:138880826-138880848 6:138880854-138880876
Sequence CCGTAGCCCCCGTGAAGTCCCCT CTGAACAGCACAAACCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 84} {0: 1, 1: 0, 2: 2, 3: 20, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!