ID: 1016166055_1016166061

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1016166055 1016166061
Species Human (GRCh38) Human (GRCh38)
Location 6:140945071-140945093 6:140945122-140945144
Sequence CCAACAGCTCGAACTGTGTCCCT CTGTGAAAGCAGCAGGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!