ID: 1016281869_1016281874

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1016281869 1016281874
Species Human (GRCh38) Human (GRCh38)
Location 6:142427569-142427591 6:142427599-142427621
Sequence CCCAAGTTGCTTCCACATATTTG TTTCAGCAGCACCATACTTCTGG
Strand - +
Off-target summary {0: 2, 1: 334, 2: 712, 3: 1570, 4: 2391} {0: 1, 1: 0, 2: 18, 3: 77, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!