ID: 1016379170_1016379174

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1016379170 1016379174
Species Human (GRCh38) Human (GRCh38)
Location 6:143456149-143456171 6:143456176-143456198
Sequence CCAGTCTTTCATATTGAGGATGA ATTTAGACACAGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 173} {0: 1, 1: 0, 2: 3, 3: 60, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!