ID: 1016396975_1016396978

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1016396975 1016396978
Species Human (GRCh38) Human (GRCh38)
Location 6:143634659-143634681 6:143634700-143634722
Sequence CCAAGATGATAAAAGACAATAGT CAGGCTGATGACTTTGTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!