ID: 1016419614_1016419616

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1016419614 1016419616
Species Human (GRCh38) Human (GRCh38)
Location 6:143870672-143870694 6:143870706-143870728
Sequence CCAGTAACAGGCCAAGAGCTGTC GAGTAATTATCTGTAGAAGATGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} {0: 1, 1: 13, 2: 202, 3: 228, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!