ID: 1016469581_1016469589

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1016469581 1016469589
Species Human (GRCh38) Human (GRCh38)
Location 6:144361206-144361228 6:144361258-144361280
Sequence CCACCCACTTTCTTTACACCATA AAAGACTAGCTTGTAGTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!