ID: 1016573153_1016573159

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1016573153 1016573159
Species Human (GRCh38) Human (GRCh38)
Location 6:145537288-145537310 6:145537322-145537344
Sequence CCATTGTCAATTTGTATATTCAA CAATAGAACATGGGTTAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!