ID: 1016622169_1016622174

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1016622169 1016622174
Species Human (GRCh38) Human (GRCh38)
Location 6:146123613-146123635 6:146123635-146123657
Sequence CCAATACCCAACTGTGCCTCCAG GTCCCTGCTGTCTTTGATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!