ID: 1016658228_1016658235

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1016658228 1016658235
Species Human (GRCh38) Human (GRCh38)
Location 6:146544435-146544457 6:146544480-146544502
Sequence CCAGGACTAGTTGAGAAGGCTGC CAGCCTCAACTCAAGTTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98} {0: 1, 1: 0, 2: 1, 3: 13, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!