ID: 1016739070_1016739090

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1016739070 1016739090
Species Human (GRCh38) Human (GRCh38)
Location 6:147509141-147509163 6:147509194-147509216
Sequence CCTCTACTTCACGCTTGAGCCGC CCGTCCCCACCGGCCGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29} {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!