ID: 1016808305_1016808313

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1016808305 1016808313
Species Human (GRCh38) Human (GRCh38)
Location 6:148235160-148235182 6:148235208-148235230
Sequence CCAAACCCAATTCTGCAAAGAAC ATGTGTATGGTGGAGGTGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!