ID: 1016826809_1016826812

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1016826809 1016826812
Species Human (GRCh38) Human (GRCh38)
Location 6:148395995-148396017 6:148396024-148396046
Sequence CCCCAGCAGCACTCTGTTGATGA ACTCATCAGCAGCTGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127} {0: 1, 1: 0, 2: 2, 3: 35, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!