ID: 1016832254_1016832263

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1016832254 1016832263
Species Human (GRCh38) Human (GRCh38)
Location 6:148445661-148445683 6:148445709-148445731
Sequence CCTCAAAGTGGCTGCTGCATCTT AAGAGAGGGAAGAAGGCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 197} {0: 1, 1: 0, 2: 13, 3: 132, 4: 1354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!