ID: 1016892752_1016892761

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1016892752 1016892761
Species Human (GRCh38) Human (GRCh38)
Location 6:149022739-149022761 6:149022772-149022794
Sequence CCAGAGAGCCCTGGATCCCGTTG AGGTGGCCCTACCACCATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 90} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!