ID: 1016987209_1016987214

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1016987209 1016987214
Species Human (GRCh38) Human (GRCh38)
Location 6:149904593-149904615 6:149904617-149904639
Sequence CCCCATCTGAAAGAGCTTAAAGG AAGCTTGCATGGCTTTTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 153} {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!