ID: 1016989024_1016989029

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1016989024 1016989029
Species Human (GRCh38) Human (GRCh38)
Location 6:149916725-149916747 6:149916753-149916775
Sequence CCCTCCTTTTCAATTAGGTGTAC CTCTCCCAGCCCCCTCCTTCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 187} {0: 1, 1: 2, 2: 9, 3: 72, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!