ID: 1017098966_1017098974

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1017098966 1017098974
Species Human (GRCh38) Human (GRCh38)
Location 6:150830907-150830929 6:150830957-150830979
Sequence CCAGCTCTGGTCACAGGATTGTC AACACATGCCCTCCTGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125} {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!