ID: 1017103218_1017103228

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1017103218 1017103228
Species Human (GRCh38) Human (GRCh38)
Location 6:150866123-150866145 6:150866158-150866180
Sequence CCGCCGTGGGGAGCGGGGCGCGG TTGGTGCCAACTCATTAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 246} {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!