ID: 1017126349_1017126352

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1017126349 1017126352
Species Human (GRCh38) Human (GRCh38)
Location 6:151067893-151067915 6:151067932-151067954
Sequence CCAAATGAACTCTGATGTGTCTC CTTCTGGTGCATGTAAACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147} {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!