ID: 1017146496_1017146510

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1017146496 1017146510
Species Human (GRCh38) Human (GRCh38)
Location 6:151240191-151240213 6:151240242-151240264
Sequence CCGAGGGCCGGGTGGGCGGCTGC CTCTGGTCCCGGCAGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 258} {0: 1, 1: 0, 2: 2, 3: 31, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!