ID: 1017147455_1017147459

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1017147455 1017147459
Species Human (GRCh38) Human (GRCh38)
Location 6:151247552-151247574 6:151247601-151247623
Sequence CCATCTTTAAATTTATTTGCTTG ACTTTTAAAATTTCTTCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 784} {0: 1, 1: 0, 2: 12, 3: 118, 4: 1005}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!