ID: 1017248082_1017248086

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1017248082 1017248086
Species Human (GRCh38) Human (GRCh38)
Location 6:152249373-152249395 6:152249388-152249410
Sequence CCAGGAGAAACAATACTGTGCTA CTGTGCTATGGGAAGGTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118} {0: 1, 1: 0, 2: 2, 3: 23, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!