|
Left Crispr |
Right Crispr |
Crispr ID |
1017260097 |
1017260106 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:152375985-152376007
|
6:152376021-152376043
|
Sequence |
CCTTTTTGGCACCAGGGAGTGGT |
ATTTTTCCACAGATGGGGTGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 537, 2: 849, 3: 1262, 4: 1189} |
{0: 8, 1: 32, 2: 102, 3: 250, 4: 712} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|