ID: 1017359002_1017359007

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1017359002 1017359007
Species Human (GRCh38) Human (GRCh38)
Location 6:153543660-153543682 6:153543698-153543720
Sequence CCCACTTCCCTCTAGTCTTTCTT AGAGAAAAATAATATCAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 23, 3: 338, 4: 2955}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!