ID: 1017431059_1017431064

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1017431059 1017431064
Species Human (GRCh38) Human (GRCh38)
Location 6:154371195-154371217 6:154371236-154371258
Sequence CCAGTAGCTGCCAAGAAGGATAA GTAAACTCACCACAGTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} {0: 1, 1: 0, 2: 0, 3: 14, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!