ID: 1017432026_1017432031

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1017432026 1017432031
Species Human (GRCh38) Human (GRCh38)
Location 6:154380994-154381016 6:154381015-154381037
Sequence CCCTCAGTTAGGGAGCCCTATCA CACACTGGCCCTGTTATGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58} {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!