ID: 1017491138_1017491145

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1017491138 1017491145
Species Human (GRCh38) Human (GRCh38)
Location 6:154946208-154946230 6:154946221-154946243
Sequence CCTTCCACCCTCCCCTTCCCCAC CCTTCCCCACTCCCAGCCTCTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 18, 3: 197, 4: 1189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!