ID: 1017494562_1017494568

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1017494562 1017494568
Species Human (GRCh38) Human (GRCh38)
Location 6:154972097-154972119 6:154972127-154972149
Sequence CCTCCCAGAGGCTGGGATTACAG GCACCTTGCCTGGCTAAATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!