ID: 1017522209_1017522218

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1017522209 1017522218
Species Human (GRCh38) Human (GRCh38)
Location 6:155212707-155212729 6:155212758-155212780
Sequence CCTGGCAGGCTGTGCTCAACTTG AAGAGTGAGCAGAGTGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 30, 3: 135, 4: 367} {0: 1, 1: 1, 2: 10, 3: 34, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!